Antimicrobial susceptibility determination. 

Antimicrobial MICs for E. coli isolates were determined using the Sensititre automated antimicrobial susceptibility system (Trek Diagnostic Systems, Westlake, Ohio) and interpreted according to the NCCLS guidelines for broth microdilution methods (24, 25). Sensititre susceptibility testing was performed according to the manufacturer's instructions. The following antimicrobials were assayed: amikacin, amoxicillin-clavulanic acid, ampicillin, apramycin, ceftiofur, ceftriaxone, cephalothin, chloramphenicol, ciprofloxacin, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, sulfamethoxazole, tetracycline, and trimethoprim-sulfamethoxazole. E. coli ATCC 25922, E. coli ATCC 35218, and Pseudomonas aeruginosa ATCC 27853 were used as controls in MIC determinations.

PCR, isolation, and sequencing of the E. coli flo and cmlA genes. 

Oligonucleotides were synthesized by Biosynthesis (Lewisville, Tex.). The PCR-derived flo probe was obtained using previously published primers (9) and yielded a 215-bp amplicon within the coding region. Two additional PCR primers were created flanking the entire pp-flo gene. E. coli Flo-F corresponded to nucleotides 981 to 1004 (TTGTTGTTGCGGCGCTCTGTAAGG), and E. coli Flo-R corresponded to nucleotides 2405 to 2384 (CGGCGACGGCGATGAACTGAAC) of the published sequence (GenBank accession no. D37826), yielding a predicted amplicon of 1,424 bp. The PCR-derived cmlA probe was amplified using previously published primers (18) and yielded a 698-bp amplicon. PCRs were carried out in a thermocycler 2400 (Perkin-Elmer Applied Biosystems, Norwalk, Conn.). Two hundred microliters of each PCR product was separated by 1.5% agarose gel electrophoresis at 75 V for 2 h. The appropriate bands were excised and purified utilizing GenElute Spin columns (Supelco, Bellefonte, Pa.). The purified PCR amplicons were sequenced at the University of Minnesota Advanced Genetic Analysis Center, St. Paul, Minn. Sequence comparisons were made using the NCBI-BLAST program (2).

PFGE. 

Five-milliliter broth cultures of each isolate were grown overnight at 37°C. The cell pellet was collected, embedded in agarose plugs, and lysed as previously described (5, 30). Agarose plugs were digested with 10 U of XbaI (Promega, Madison, Wis.) overnight at 37°C. Digested DNA was separated on a 1.2% agarose gel using the CHEF-DRII pulsed-field gel electrophoresis (PFGE) system (Bio-Rad, Hercules, Calif.). Electrophoresis was carried out for 25 h at 6 V with a ramped pulse time of 2 to 40 s in 0.5× Tris-borate-EDTA (TBE) buffer (14°C). Molecular weight standards were Saccharomyces cerevisiae YPH 755 chromosomes (Roche Biochemicals, Indianapolis, Ind.). Gel documentation and phylogenetic analysis of the E. coli isolates were performed using the RFLPScan and TREECON programs as previously described (21).

Mapping of the flo gene in bovine E. coli isolates. 

The flo gene was initially identified in a transferable R plasmid in the fish pathogen P. piscicida (18). A flo homolog was recently mapped within a multidrug resistance locus that is flanked by two class 1 integrons in serovar Typhimurium DT104 and serovar Agona (3, 11, 13). PCR primers were developed to determine if the E. coli flo gene had a genetic organization similar to that observed in either serovar Typhimurium DT104 or P. piscidida. The first PCR primers were designed to amplify a portion of flo and genes mapping downstream (tetR) within the Salmonella multidrug resistance (MDR) locus (GenBank accession no. AF071555). The second PCR set was targeted to flo and the broad-host-range plasmid RSF1010 replicon identified in P. piscicida (GenBank accession no. D37826). Primers flomap2F (GGGATCGGCGAAACTTTAC) and flomap2R (TGTGGTCGGTTCCGTTCTC) anneal at nucleotide positions 5330 of flo and 6073 of tetR within the serovar Typhimurium DT104 (GenBank accession no. AF07155), resulting in a 744-bp amplicon. Primers flomap2F (GGGATCGGCGAAACTTTAC) and pp-floMapR (TCCGCGTCCTTGCAATAC) anneal to nucleotide positions 1953 and 2723 of the P. piscicida plasmid-mediated flo sequence (GenBank accession no. D37826), resulting in a 771-bp amplicon. The PCR conditions used have been previously described (17).

Detection of high-molecular-weight plasmids by S1 nuclease treatment and PFGE. 

Due to their structure, large circular plasmids are not resolved by PFGE. This problem can be overcome by using S1 nuclease digestion prior to PFGE. S1 nuclease creates breaks in the plasmids, which allow them to enter the agarose gel during PFGE. Agarose plugs prepared for PFGE were treated with S1 nuclease (Roche Biochemicals) as previously described (6, 22). Plasmids were separated on a 1.5% agarose gel using the CHEF-DRII PFGE system (Bio-Rad). Plasmids were electrophoresed initially for 14 h at 6 V with a pulse time of 45 s, followed by a program of 6 h at 6 V with a pulse time of 25 s. Molecular weight standards were S. cerevisiae YPH 755 chromosomes (Roche Biochemicals).

Southern hybridization analysis. 

Megabase DNA was blotted to nylon membranes using the Bio-Rad procedure. Briefly, DNA in ethidium bromide-stained gels was nicked using a UV Transilluminator (Fisher Scientific) at 60 mJ of energy. Gels were soaked in 0.4 N NaOH–1.5 M NaCl for 15 min, and then DNA was transferred for 4 h to Magnagraph nylon (MSI, Westborough, Mass.) using the model 785 Vacuum Blotter (Bio-Rad) with NaOH as the buffer. After transfer, nylon membranes were washed briefly in 0.5 M Tris, pH 7.6, followed by 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) (29). Membranes were blocked and probed with a PCR-amplified portion of the florfenicol resistance gene probe as previously described (18).

Florfenicol powder

Identification of the flo resistance gene in bovine E. coli. 

PCR primers, based on the published pp-flo nucleotide sequence, amplified a 1.4-kb PCR product from chloramphenicol- and florfenicol-resistant bovine E. coli isolates. DNA sequence analysis of the E. coli flo gene demonstrated 98% identity to the published GenBank sequences of both serovar Typhimurium flo_St and P. piscicida pp-flo (AF118107 and D37826, respectively). DNA sequence analysis using the NCBI-BLAST program (2) predicted an open reading frame (ORF) of 1,215 bp, demonstrating the greatest identity (98%) with the pp-flo gene from P. piscicida (19), the cmlA-like gene described in the DT104 MDR locus (11), and the flo_St gene described by Bolton et al. (9). This 1,215-bp ORF translates into a hypothetical protein of 404 amino acids. Using BLAST-p (2), it was determined that this hypothetical protein demonstrated 98 and 89% amino acid sequence homology with the previously described flo_St and pp-flo gene products, respectively. There was also 49% identity between the E. coli hypothetical Flo protein and the previously described nonenzymatic chloramphenicol resistance gene product CmlA.

Evidence that the flo resistance gene is widely disseminated among bovine E. coli isolates. 

Forty-one (85%) of the E. coli isolates assayed were resistant to both chloramphenicol (MIC, ≥32 μg/ml) and florfenicol (MIC, ≥16 μg/ml). For 36 of these E. coli isolates, florfenicol MICs were ≥128 μg/ml, higher than those previously reported for florfenicol-resistant E. coli (9) but comparable to MICs observed for serovar Typhimurium DT104 (18). These isolates were further analyzed for the presence of both flo and cmlA efflux genes. Forty-two of 44 isolates that displayed decreased susceptibilities to florfenicol (MIC, ≥16 μg/ml) were positive by PCR for the flo gene (Table ​(Table2).2). All E. coli isolates for which florfenicol MICs were ≤8 μg/ml were negative for the flo gene (n = 4).

Twelve E. coli isolates were positive by PCR for the cmlA gene. Additionally, eight isolates were positive for both flo and cmlA genes, and both florfenicol and chloramphenicol MICs for these isolates were elevated (≥64 μg/ml) (Table ​(Table2).2). Four isolates were negative for flo but positive for cmlA. Interestingly, for two of these four isolates, florfenicol MICs were elevated (≥16 μg/ml). The putative chloramphenicol efflux gene cmlA has previously been shown not to confer resistance to florfenicol and has been further identified on a transposable element in P. aeruginosa (7, 14, 18). However, there is very little information regarding the presence of cmlA in E. coli and resulting resistance phenotypes. It is possible that the cmlA genes in the two florfenicol-resistant bovine E. coli isolates that lack flo accumulated mutations resulting in florfenicol being recognized as an efflux substrate. Further research on these two strains is certainly warranted.

To determine whether florfenicol-resistant bovine E. coli isolates represented dissemination of a clonal strain, 45 of the 48 isolates were analyzed by PFGE. Using the neighbor-joining method and rooting the tree against E. coli strain LE392 (K-12), 44 different branches were observed (Fig. ​(Fig.1).1). Only two isolates, CVM1814 and CVM1816, displayed the same PFGE pattern. This extreme genetic diversity suggests that florfenicol resistance is not limited to a particular chromosomal background and is most likely due to dissemination of the flo gene via mobile transposons and/or a plasmid(s).

 

FIG. 1

Phylogenetic tree of florfenicol-resistant bovine E. coli. Total DNA was digested with XbaI and separated by PFGE. Molecular weight markers were S. cerevisiae strain YPH 755 chromosomes. Similarities among E. coli PFGE patterns were identified by cluster analysis using the neighbor-joining method to draw a phylogenetic tree (21). Phylogenetic analysis identified 44 PFGE patterns in the 45 florfenicol-resistant bovine E. coli isolates assayed.

The flo resistance gene maps to high-molecular-weight plasmids in bovine E. coli. 

Recently, Briggs and Fratamico characterized the MDR locus of the penta-antibiotic-resistant serovar Typhimurium DT104 (11). This locus contains the florfenicol resistance gene flo, which is flanked on one side by a class 1 integron containing the streptomycin/spectinomycin resistance gene aadA2 and on the other by the tetracycline resistance gene, tetA (3, 11, 13). To determine whether flo-positive bovine E. coli isolates have a similar genetic organization, PCR primers targeted to flo and genes downstream in the MDR locus of serovar Typhimurium DT104 were designed (Fig. ​(Fig.2).2). PCR analysis of a serovar Typhimurium DT104 isolate resulted in a PCR product of approximately 750 bp, corresponding in size to the predicted amplicon between flo and tetR (Fig. ​(Fig.2).2). No PCR amplicons were observed for primers anchored in DNA sequences downstream of the DT104 MDR locus and flo in the florfenicol-resistant bovine E. coli isolates. However, several florfenicol-resistant bovine E. coli isolates yielded 770-bp amplicons using PCR primers within flo and downstream within the P. piscicida R plasmid RSF1010 replicon (Fig. ​(Fig.2).2). This suggests horizontal transfer of the E. coli flo gene via acquisition of large broad-host-range plasmids.

 

FIG. 2

Comparison of the location of the flo gene in serovar Typhimurium DT104, P. piscicida, and E. coli. PCR primers were designed to amplify a portion of flo and genes mapping downstream (tetR) within the Salmonella MDR locus or to amplify flo and the RSF1010 replicon identified in P. piscicida. Primers flomap2F and pp-floMapR anneal to nucleotide positions 1953 and 2723 of the P. piscicida plasmid-mediated flo sequence, resulting in a 771-bp amplicon. Primers flomap2F and flomap2R anneal at nucleotide positions 5330 of flo and 6073 of tetR within the serovar Typhimurium DT104 MDR locus, resulting in a 744-bp amplicon.

Since PCR mapping indicated linkage between flo and the RSF1010 replicon sequence, we preceded to confirm the position of flo on a plasmid(s) in bovine E. coli. The flo gene was identified on high-molecular-weight plasmids by S1 nuclease digestion and PFGE. The flo resistance gene mapped to bovine E. coli plasmids of approximately 225 kb. These plasmids were larger than previously described flo-containing plasmids in avian E. coli (18). The presence of such large plasmids is not unprecedented in E. coli. Mitsuda et al. previously reported the presence of a 170-kb plasmid in an ETEC isolate (22). Additionally, the original report of florfenicol resistance among P. piscicida strains attributed it to a high-molecular-weight transferable R plasmid (19). Not all of the flo-positive bovine E. coli isolates contained the large flo-positive plasmids, indicating that some of the genes are chromosomally located. Like serovar Typhimurium DT104 and serovar Agona, the flo gene in these bovine E. coli isolates appears to be chromosomally located. However, the flo genes mapped to a variety of different XbaI DNA fragments in bovine E. coli (Fig. ​(Fig.3).3). This is in contrast to the common 10-kb XbaI DNA fragment containing flo in serovar Typhimurium DT104 (11), and may be due to chromosomal integration of flo containing DNA mobile elements.

 

FIG. 3

Location of the flo resistance gene in bovine E. coli genomes by PFGE and Southern analysis. Total E. coli genomic DNA, plasmid and chromosome, was cut with XbaI, separated by PFGE, and probed with labeled flo. Lanes 2 to 15, bovine E. coli isolates. Avian E. coli strain 5790 served as the positive control for flo (lane 1).